Molecular Techniques and Methods

In vitro Transcription

Copy Right ?2001/ Institute of Molecular Development LLC

INTRODUCTION

  • This protocol generates high specific activity single-stranded RNA probe in microgram quantities.

  • Linearized plasmid DNA, and ds-PCR products that contain an RNA polymerase promoter site, can be used as templates for in vitro transcription.

  • Phage polymerase promoters: minimal sequence requirements.
    T7; TAATACGACTCACTATAGGGAGA
    SP6; ATTTAGGTGACACTATAGAAGNG
    T3; AATTAACCCTCACTAAAGGGAGA
    The underline shows the minimum promoter sequence needed for efficient transcription.

  • Total hours = 5 hrs



    MATERIALS AND SOLUTIONS

    10 x Transcription Buffer (1 ml)
    100 mM Tris-HCl (pH 7.9) ---------------- 100 ul of 1 M Tris-HCl
    15 mM MgCl2 ----------------------------- 15 ul of 1 M MgCl2
    5 mM Spermidine --------------------------- 5 ul of 1 M Spermidine
    25 mM NaCl -------------------------------- 5 ul of 5 M NaCl
    RNase-free H2O ---------------------------- 875 ul


    [a-32P] UTP (400-800 Ci/mmol and10 mCi/ ml in aqueous solution)

    {or, 35S-UTP (800 Ci/mmol and 40 mCi/ml in aqueous solution)}


    rNTP Mix (1 ml)
    10 mM ATP ---------------------------------------- 100 ul of 100 mM ATP
    10 mM CTP ---------------------------------------- 100 ul of 100 mM CTP
    10 mM GTP ---------------------------------------- 100 ul of 100 mM GTP
    0.24 mM UTP -------------------------------------- 100 ul of 2.4 mM UTP
    DEPC-H2O ----------------------------------------- 600 ul
  • Store at -20oC.


    5% Acrylamide/8 M Urea Gel (500 ml)
    Urea --------------------------------------------------- 240 g
    5 x TBE ------------------------------------------------ 100 ml
    40% Acrylamide:Bis Solution (19:1) ------------------- 62.5 ml
    Deionized H2O to make a final volume of -------------- 500 ml
  • Filter by 0.4 um millipore membrane.
  • Keep in a dark bottle at room temperature.
  • At low temperature, urea will precipitate.


    3.5% Acrylamide/8 M Urea Gel (500 ml)
    Urea --------------------------------------------------- 240 g
    5 x TBE ------------------------------------------------ 100 ml
    40% Acrylamide:Bis Solution (19:1) ------------------- 44 ml
    100% Glycerol ----------------------------------------- 90 ml
    Deionized H2O to make a final volume of --------------- 500 ml
  • Filter by 0.4 um millipore membrane.
  • Keep in a dark bottle at room temperature.
  • At low temperature, urea will precipitate.


    Gel Loading Buffer (1 ml)
    80% Formamide ----------------------------- 800 ul of 100% Formamide
    0.1% Xylene cyanol -------------------------- 20 ul of 5% Xylene cyanol
    0.1% Bromophenol blue ---------------------- 20 ul of 5% Bromophenol blue
    2 mM EDTA --------------------------------- 4 ul of 0.5 M EDTA
    RNase-free H2O ----------------------------- 156 ul


    Elution Buffer (10 ml)
    0.5 M Ammnoium acetate -------------------- 500 ul of 10 M NH4OAc
    1 mM EDTA --------------------------------- 20 ul of 0.5 M EDTA
    0.1% SDS ----------------------------------- 100 ul of 10% SDS
    RNase-free H2O ----------------------------- 9.38 ml


    PROCEDURES

    Preparation of Template DNA

    1. Linearize 5 ug of plasmid DNA containing the interested sequence with the appropriate restriction enzyme.
    An excess of enzyme and longer digestion times may be needed to achieve complete linearization. (i.e., overnight digestion in a 37oC-air incubator)
  • If using PCR products, generate ds-PCR products and clean it as follow.

    2. Check the linearity of the preparation using electrophoresis by running a 1% agarose gel in TBE buffer with ethidium bromide to visualize nucleic acids. It may be useful to run the digest on a low melting point agarose gel and extract the DNA from the agarose. This ensures that only the linearized plasmid is used for subsequent steps.

    3. Extract the DNA with an equal volume of Phenol: Chloroform: IAA.

    4. Precipitate DNA by adding 1/10 volume of 3 M Na-Acetate (pH 5.2), 10 ug of glycogen, and 2 volume of 100% ethanol.

    5. Centrifuge for 30 minutes at 15,000g (4oC).

    6. Wash pellet with ice cold 70% ethanol. Air dry briefly.

    7. Resuspend DNA to 0.5 ug/ul in RNase-free H2O.

    8. Linearized template may be stored at -20oC.


    In vitro Transcription

    9. Add the following components to a microfuge tube at room temperature.

  • For 20 ul reaction;
    5x Transcription buffer 4 µl
    rNTP Mix 4 µl
    [a-32P]-UTP, ~30 TBq/mmol (800 Ci/mmol) 1.85 MBq (50 µCi)/ 8.5 ul
    Linearized template DNA 0.2-1.0 µg/ 2ul
    RNase Inhibitor 0.5 µl (20 u)
    SP6/T3/T7 RNA Polymerase 1 µl (20 u)
    DEPC-treated Water to 20 µl


  • For 15 ul reaction;
    5x Transcription buffer 3 µl
    rNTP Mix 3 µl
    [a-32P]-UTP, ~30 TBq/mmol (800 Ci/mmol) 1.85 MBq (50 µCi)/ 6.5 ul
    Linearized template DNA 0.2-1.0 µg/ 1.5ul
    RNase Inhibitor 0.3 µl (20 u)
    SP6/T3/T7 RNA Polymerase 0.7 µl (20 u)
    DEPC-treated Water to 15 µl


  • For 10 ul reaction;
    5x Transcription buffer 2 µl
    rNTP Mix 2 µl
    [a-32P]-UTP, ~30 TBq/mmol (800 Ci/mmol) 1.85 MBq (50 µCi)/ 4.25 ul
    Linearized template DNA 0.1-0.5 µg/ 1ul
    RNase Inhibitor 0.25 µl (10 u)
    SP6/T3/T7 RNA Polymerase 0.5 µl (10 u)
    DEPC-treated Water to 10 µl


  • 10. Incubate at 37°C for 1-2 hours.
  • Do not incubate more than 2 hours. Synythesized RNA become shortened.

    11. Stop the reaction by cooling at -20°C.

    12. Determine the percentage of the label incorporated into RNA.


    Removal of Template DNA

    13. Add 1 ul of RNase-free DNase I (2 U/ul) to the reaction.

    14. Mix thoroughly, microfuge momentarily, and incubate at 37oC for 15 minutes.

    15. For Ribonuclease Protection Analysis (RPA), the labeled probe should be gel-purified to get full-length transcripts. Proceed to step 15.

  • If the probe is being used in a filter hybridization reaction, gel purificaition is not necessary.
  • Separate the transcription products from unincorporated label by ethanol precipitation or a column chromatography. Addition of 1 /10 volume 5 M Ammonium acetate and 3 volumes Ethanol works well.
  • It is generally advisable to add 10 ug of glycogen as a carrier prior to precipitation, since the actual mass of synthesized transcript can be quite small, usually on the order of 15-50 ng.


    Gel Purification of Probe

    16. For RNA size = 50-450 nt, use 5% Acrylamide/8M Urea gel.

    5% Acrylamide/8 M Urea Gel solution
    10 ml
    10% Ammonium persulfate
    125 ul
    TEMED
    25 ul

  • In 5% PAGE, xylene cyanol moves as 100 nt RNA.



  • For RNA size = 500-800 nt, use 3.5% Acrylamide/8M Urea gel.

    3.5% Acrylamide/8 M Urea Gel solution
    10 ml
    10% Ammonium persulfate
    125 ul
    TEMED
    25 ul

  • In 3.5% PAGE, xylene cyanol moves as 500 nt RNA.
  • Polymerize at least 1 hour before use.


    17. At the end of the RNase-free DNase I incubation, add an equal volume of Gel Loading Buffer.

    18. Heat the tube for 3-5 minutes at 80-90oC.

    19. Load the reaction on a 1.5 mm thick 5% Acrylamide/8 M Urea Gel.

    20. Run in Tris-Glycine-SDS Electrophoresis Buffer for about 1-3 hours at 250 volts.

    21. After electrophoresis the gel is covered with plastic wrap and exposed to X-ray film for about 2-3 minutes.
  • During exposure, mark the film by radio-labeling tape.

    22. After exposure, the film is developed and used to precisely localize the area of the gel that contains the full-length, labeled transcripts, which is usually seen as the most slowly migrating, most intense band on the autoradiograph.

    23. Aligne the film with the gel.

    24. Excise the area on the gel where the full-length, labeled transcript present with a razor blade.

    25. Transfer the gel-slice with clean forceps to a microfuge tube, and submerge in about 350-500 ul of Elution Buffer.

    26. Incubate the tube at either room temperature or 37oC.
  • Approximately 20% of the labeled probe will have eluted after about two hours.
  • However, to maximize recovery of probe from the gel, the incubation can be continued overnight.
  • The elution time is dependent on the size of the gel fragment, the transcript size and the temperature of the incubation.
  • About 50% of a 400 nt transcript should elute in about 4 hrs at 37°C.
  • By increasing the incubation temperature to 65oC, most of the probe will elute in 1 hr.
  • Larger transcripts will take longer to elute.
  • It is not necessary to elute all of the probe before proceeding to the hybridization

    27. After overnight incubation, about 95% of the label will typically have diffused out of the gel into the surrounding Elution Buffer.

    28. Add 5 ug glycogen as a career.

    29. Do phenol: chloroform: IAA (25:24:1) extraction, 2x.
  • Do chloroform: IAA (24:1) extraction, 1x.

    30. Precipitate with 2 vol. of ethanol.

    31. Pellet and resuspend in 100 ul of appropriate buffer or DEPC-H2O to make 50,000 cpm/ul (2.2 fmol).

    32. The amount of radioactive label in an aliquot of the eluted probe is determined by scintillation counting.

    33. Store at -20oC.




    NOTES

  • Linearize the plasmid with the appropriate restriction enzyme in a 50 ul volume. A clean plasmid preparation is needed; however, it is possible to use miniprep DNA if extra steps are taken to remove contaminatitig proteins. The template DNA should be linearized by digestion to completion with a suitable restriction enzyme to obtain transcripts of a defined length. It is preferable to use enzymes which cleave the DNA leaving either a 5'-overhang or blunt ends. A low level of transcription from 3'-overhanging ends (produced by Kpn 1, Pst 1, etc.) has been observed.

  • The exact incubation temperature is not critical. Little difference in synthesis yield has been seen at either room temperature or 37oC.

  • Gel purification has the advantage over other purification methods of separating full length from shorter transcription products, so that the probe is recovered free from prematurely terminated transcripts as well as unincorporated label.


    KIT INFORMATION




    REFERENCES

  • Schenborn, ET, Mierindorf, RC (1985) Nucleic Acids Research 13, 6223.

  • Please send your comment on this protocol to "editor@MolecularInfo.com".

  • Home
    MT&M
    Online Journal
    Hot Articles
    Order Products
    Classified